DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_091291c
Line Availability available from NASC (N663301) and ABRC (SALK_091291c)
Confirmed for Hit At2g45140
Parent of DUPLO pair none
Parent of pair(s) 2307, 93861

Gene hit At2g45140

 
Sequence (A. th genome BLAST matches underlined) 
GTTGAAGTTCAGATCATTCCAGTTATTAGCAACTTAATGGCTCTTTTATTGTACACTGCT
TGATGTGAAATTCTCAAACCTATTAGGCCAATAATCTTAACTTTTTGTTTATTACTGAAG
AATT
GenBank Accession BH902107 [GenBank]
Graphic View Graphic view of gene At2g45140
Predicted Position of Insertion Chr2:18612172 - go to primer design
BLAST e Value 9e-65
Hit Clone Code (BAC ID) T14P1
Hit Gene Code At2g45140 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plant VAP homolog 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37