DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_092885
Line Availability available from NASC (N592885) and ABRC (SALK_092885)
Confirmed for Hit At1g20350
Parent of DUPLO pair 2810
Parent of pair(s) none

Gene hit At1g20350

 
Sequence (A. th genome BLAST matches underlined) 
CTCCGACTAAAGCCGATCTAGCAGACGCGCCTAAGCCTTGACGCAACGAGAGGAATCCTC
CAGTGGCTGCACCAGATAAGATCGAGTTCCATGGATCTTCCTTTTGTCTTGCGTACACCA
ACGCACAATCGAAGGTTGAGTAAAGACCACCCCACACGGAGAAGCT
GenBank Accession BZ596634 [GenBank]
Graphic View Graphic view of gene At1g20350
Predicted Position of Insertion Chr1:7044094 - go to primer design
BLAST e Value 1e-89
Hit Clone Code (BAC ID) F14O10
Hit Gene Code At1g20350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase inner membrane subunit 17-1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37