DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_096470c
Line Availability available from NASC (N654796) and ABRC (SALK_096470c)
Confirmed for Hit At1g04300
Parent of DUPLO pair 2261
Parent of pair(s) none

Gene hit At1g04300

 
Sequence (A. th genome BLAST matches underlined)
CTTGCGGATGTGGATTGAATATGCTTCTGCTATACACCATGTTGCTGCACTGTTCGTCTT
CCA
GenBank Accession BZ596881 [GenBank]
Graphic View Graphic view of gene At1g04300
Predicted Position of Insertion Chr1:1149126 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) F19P19
Hit Gene Code At1g04300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TRAF-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37