DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_099019c
Line Availability available from NASC (N663446) and ABRC (SALK_099019c)
Confirmed for Hit At1g55920
Parent of DUPLO pair none
Parent of pair(s) 2583, 88062

Gene hit At1g55920

 
Sequence (A. th genome BLAST matches underlined)
TGGCAACATGCATAGACACATGCCGAACCGGTAATACCCAAGACGATGATT
GenBank Accession ED602013 [GenBank]
Graphic View Graphic view of gene At1g55920
Predicted Position of Insertion Chr1:20912379 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) F14J16
Hit Gene Code At1g55920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation serine acetyltransferase 2;1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37