DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_104250
Line Availability available from NASC (N604250) and ABRC (SALK_104250)
Confirmed for Hit At1g05750
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g05750

 
Sequence (A. th genome BLAST matches underlined)
ATGAAAGTGATGTGGTTAGGCTCTACGCCGGCGAGTGTCATATCGGAGAATT
GenBank Accession BH904280 [GenBank]
Graphic View Graphic view of gene At1g05750
Predicted Position of Insertion Chr1:1721746 - go to primer design
BLAST e Value 3e-22
Hit Clone Code (BAC ID) T20M3
Hit Gene Code At1g05750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37