DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_105170c
Line Availability available from NASC (N655802) and ABRC (SALK_105170c)
Confirmed for Hit At1g30650
Parent of DUPLO pair 2523
Parent of pair(s) none

Gene hit At1g30650

 
Sequence (A. th genome BLAST matches underlined)
AAGATACTACATTGGCTCTTTGTATGACCCTCCTCCAATACCTGGTGCGAACCAAGAATC
GCGCCCTGGGCCGAGCCATAAAATACCCGGAGTTTGTGATGGAGTTTANTTCTTGGAGGA

GenBank Accession BH904823 [GenBank]
Graphic View Graphic view of gene At1g30650
Predicted Position of Insertion Chr1:10868856 - go to primer design
BLAST e Value 2e-10
Hit Clone Code (BAC ID) T5I8
Hit Gene Code At1g30650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 14
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37