DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_114838c
Line Availability available from NASC (N668889) and ABRC (SALK_114838c)
Confirmed for Hit At1g51220
Parent of DUPLO pair 11973
Parent of pair(s) none

Gene hit At1g51220

 
Sequence (A. th genome BLAST matches underlined)
TAAACATGGGTCTAAACCATTTGCTTGTCGTATGTGTGGTAAGGCCTTTGCAGTGAAAGG
AGATTGGAGAACGCATGAGAAGAATTGTGGAAAGCT
GenBank Accession BZ380240 [GenBank]
Graphic View Graphic view of gene At1g51220
Predicted Position of Insertion Chr1:18990174 - go to primer design
BLAST e Value 3e-48
Hit Clone Code (BAC ID) F11M15
Hit Gene Code At1g51220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WIP domain protein 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37