DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_118939
Line Availability available from NASC (N618939) and ABRC (SALK_118939)
Confirmed for Hit At1g69720
Parent of DUPLO pair none
Parent of pair(s) 805, 9703

Gene hit At1g69720

 
Sequence (A. th genome BLAST matches underlined)
AATCGAAGTTGGAATATTTTCTGAAAGTTTACGATCAGTTATGCAGGTATCTAAGAAGAT
ACTAGATAATAAAGAACTCGAGTTCTATAAATGGGACGGTCAACTTTCTCAGTTGTTGCA
AAATGTGAGGCAAAAACTGAACAAAGTTGCAGAGGTATTGAACTTTACACTACTCTATTG
AACAAAGAAGAATATTCTAATGGCTAATGTGGATTTTGAATGGGCAGTGGTGGACAAGAG
AAGAA
GenBank Accession CC458453 [GenBank]
Graphic View Graphic view of gene At1g69720
Predicted Position of Insertion Chr1:26228100 - go to primer design
BLAST e Value 1e-136
Hit Clone Code (BAC ID) T6C23
Hit Gene Code At1g69720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heme oxygenase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CC458453 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37