DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_138712c
Line Availability available from NASC (N677130) and ABRC (SALK_138712c)
Confirmed for Hit At3g57920
Parent of DUPLO pair 2727
Parent of pair(s) none

Gene hit At3g57920

 
Sequence (A. th genome BLAST matches underlined)
TTATTATGTGGTCTTGTCTCTTGTCTTATGCATTATTTAGGATGCTTCTCTTTGAAGCT
GenBank Accession BZ767341 [GenBank]
Graphic View Graphic view of gene At3g57920
Predicted Position of Insertion Chr3:21445358 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g57920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation squamosa promoter binding protein-like 15
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37