DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_140623c
Line Availability available from NASC (N654927) and ABRC (SALK_140623c)
Confirmed for Hit At2g24420
Parent of DUPLO pair 2416
Parent of pair(s) none

Gene hit At2g24420

 
Sequence (A. th genome BLAST matches underlined) 
TCGCGGCCGCCATGTCTGAAACTTCCGTGGAACAAAATAAGAAAGTGATCTCGCCGGGAA
TTTGCCAACAAGAAGATTTTTCGTTCTCTTCTCCGAATTTATGAATTTGTTTTGTTTGAT
CAAATTGGGACACTG
GenBank Accession BZ768719 [GenBank]
Graphic View Graphic view of gene At2g24420
Predicted Position of Insertion Chr2:10380159 - go to primer design
BLAST e Value 2e-62
Hit Clone Code (BAC ID) T28I24
Hit Gene Code At2g24420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA repair ATPase-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37