DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_142359c
Line Availability available from NASC (N672221) and ABRC (SALK_142359c)
Confirmed for Hit At1g01440
Parent of DUPLO pair 2289
Parent of pair(s) none

Gene hit At1g01440

 
Sequence (A. th genome BLAST matches underlined) 
AGAAACGATGAATAGAATGATTTAAATTCTTCTTCTTCTAAGAACACAACCACCAGAAAA
AACCCAATTCAATACACTGATAAACAACAAGCCGAGCTTTTGAGAAAGCT
GenBank Accession BZ769548 [GenBank]
Graphic View Graphic view of gene At1g01440
Predicted Position of Insertion Chr1:162054 - go to primer design
BLAST e Value 2e-37
Hit Clone Code (BAC ID) F6F3
Hit Gene Code At1g01440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein (DUF3133)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37