DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_144401
Line Availability available from NASC (N644401) and ABRC (SALK_144401)
Confirmed for Hit At3g53960
Parent of DUPLO pair 2721
Parent of pair(s) none

Gene hit At3g53960

 
Sequence (A. th genome BLAST matches underlined)
CTAAAGAGATTTTTTTGAATTATATCTATAAAATAACTTTATGTGTGAAGTATTTTTTAC
GTTATAGTCTTATGGTTTGATATATGCATAAAGGTATCGAATTGCAGCCGGGCGCCCATC
AGACCAAA
GenBank Accession CC797046 [GenBank]
Graphic View Graphic view of gene At3g53960
Predicted Position of Insertion Chr3:19980705 - go to primer design
BLAST e Value 1e-42
Hit Clone Code (BAC ID) F5K20
Hit Gene Code At3g53960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37