DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_004447
Line Availability available from NASC (N504447) and ABRC (SALK_004447)
Confirmed for Hit At1g17750
Parent of DUPLO pair 2535
Parent of pair(s) none

Gene hit At1g17750

 
Sequence (A. th genome BLAST matches underlined) 
TTGAATCACGCTGACGTCTCGTATAATTGGGGCACGGGTCCTATACCCGAATCTCTGATA
TCACATTCTTCGAAGGAATCTGGACATCCAGACCTCTGCATGCTATCTGCAGACCGGACA
GTCGACCACGCTCGGCCATAACGGAGGAAAAGCTCCTAGAAAATTATTGTCACTGAGAAC
TAAAGTGGACAAGCT
GenBank Accession ED604073 [GenBank]
Graphic View Graphic view of gene At1g17750
Predicted Position of Insertion Chr1:6108442 - go to primer design
BLAST e Value 5e-18
Hit Clone Code (BAC ID) F11A6
Hit Gene Code At1g17750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PEP1 receptor 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37