DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_012172c
Line Availability available from NASC (N673837) and ABRC (SALK_012172c)
Confirmed for Hit At4g31570
Parent of DUPLO pair none
Parent of pair(s) 6758

Gene hit At4g31580

 
Sequence (A. th genome BLAST matches underlined) 
AAACACAGAAAAAGCCATTCTTTTTGCCCCTTGAGTGCTTTCAGCTCTTCCCACAAGGTA
GGTCGCAACCAAGTTTCTTTATCTCCTTCTCACTCTTAATTGTGGGAACGTTGATCCGAT
CTGTTCAATTTGATCGGGTC
GenBank Accession ED572776 [GenBank]
Graphic View Graphic view of gene At4g31580
Predicted Position of Insertion Chr4:15306711 - go to primer design
BLAST e Value 1e-67
Hit Clone Code (BAC ID) F3L17
Hit Gene Code At4g31580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation serine/arginine-rich 22
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit ED572776 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37