DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_012890c
Line Availability available from NASC (N678121) and ABRC (SALK_012890c)
Confirmed for Hit At1g63930
Parent of DUPLO pair none
Parent of pair(s) 2734, 96897

Gene hit At1g63930

 
Sequence (A. th genome BLAST matches underlined)
GCTTCGTAAGCTGATGGATGTTTTCCTCTGTTGCGAAGCTGAATT
GenBank Accession ED573282 [GenBank]
Graphic View Graphic view of gene At1g63930
Predicted Position of Insertion Chr1:23728157 - go to primer design
BLAST e Value 3e-18
Hit Clone Code (BAC ID) T12P18
Hit Gene Code At1g63930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation from the Czech 'roh' meaning 'corner'
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37