DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_014538
Line Availability available from NASC (N800003) and ABRC (SALK_014538)
Confirmed for Hit At1g73080
Parent of DUPLO pair 2535
Parent of pair(s) none

Gene hit At1g73080

 
Sequence (A. th genome BLAST matches underlined) 
TCTGATAAGATCCCAGATACTCTCGATAGCTTGAAGAGGTTGGAGGTGCTTTATCTTTAC
ATAAACTTCCTCACTGGTGAGTTACCTGAATCCTTGTTTCGAATT
GenBank Accession ED574644 [GenBank]
Graphic View Graphic view of gene At1g73080
Predicted Position of Insertion Chr1:27484918 - go to primer design
BLAST e Value 2e-53
Hit Clone Code (BAC ID) F3N23
Hit Gene Code At1g73080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PEP1 receptor 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37