DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_017267
Line Availability available from NASC (N517267) and ABRC (SALK_017267)
Confirmed for Hit At2g45440
Parent of DUPLO pair 2308
Parent of pair(s) none

Gene hit At2g45440

 
Sequence (A. th genome BLAST matches underlined) 
TCGAAGAGTACACTGAGAATGGGGTTGTTGTAGTGGAGTGGGAATGATGATGAGTGTCAT
GATTCCAGATGGGATTATGGAGCAACAGGAGTTATATCAGTTACTAGTAATTTAGTTCCG
GGTTTGATGAGGAAGTTGATGTTTGAAGGTAGGAATT
GenBank Accession ED576827 [GenBank]
Graphic View Graphic view of gene At2g45440
Predicted Position of Insertion Chr2:18732458 - go to primer design
BLAST e Value 1e-79
Hit Clone Code (BAC ID) F4L23
Hit Gene Code At2g45440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation dihydrodipicolinate synthase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37