DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_022689c
Line Availability available from NASC (N669471) and ABRC (SALK_022689c)
Confirmed for Hit At2g40850
Parent of DUPLO pair 12034
Parent of pair(s) none

Gene hit At2g40850

 
Sequence (A. th genome BLAST matches underlined) 
GTGGACAGAGAGTGCCCACCGTTCGTGCTCTTGTGGCTGAGGTGACCATGGCTATGGTTT
TCTGGAGCTCACCCTTTGCTTTTACCAGGTGGCATTGGGAGGTTGCTTATCTCTTGCAAA
CCCGGAAAGGG
GenBank Accession BZ289292 [GenBank]
Graphic View Graphic view of gene At2g40850
Predicted Position of Insertion Chr2:17051873 - go to primer design
BLAST e Value 5e-45
Hit Clone Code (BAC ID) T20B5
Hit Gene Code At2g40850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phosphoinositide 4-kinase gamma 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37