DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_022993c
Line Availability available from NASC (N672335) and ABRC (SALK_022993c)
Confirmed for Hit At1g74080
Parent of DUPLO pair 2740
Parent of pair(s) none

Gene hit At1g74080

 
Sequence (A. th genome BLAST matches underlined) 
AGAAATGTCTGGTCAAGAAAGGTATTGATCCGTTGACCCACAAATCCCTTCTCGATGGAG
CCGGTAAATCATCTGACCATTCCGCGCATCCCGAGAAAAGCAGCGTTCTTGACGACAAAG
ATGATCAGA
GenBank Accession BZ289594 [GenBank]
Graphic View Graphic view of gene At1g74080
Predicted Position of Insertion Chr1:27856768 - go to primer design
BLAST e Value 2e-65
Hit Clone Code (BAC ID) F2P9
Hit Gene Code At1g74080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 122
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37