DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_026688c
Line Availability available from NASC (N656310) and ABRC (SALK_026688c)
Confirmed for Hit At2g39690
Parent of DUPLO pair 2798
Parent of pair(s) none

Gene hit At2g39690

 
Sequence (A. th genome BLAST matches underlined)
TAAAGGAACTTTAGCTTTTCTGTCTAGACATTCAATAATCTTGCCCTTTAAGTTNACTGA
TCGAGGCATCTGGCTATAGATCCCTCCCAAAGAGATTAATGTGATCAGCAAAAGCTCTGA
TGTGCCATAGCAGATGCTGAGGATCCGCAATCTATTACTGGCTTGAAACACCGACAGA
GenBank Accession BZ663192 [GenBank]
Graphic View Graphic view of gene At2g39690
Predicted Position of Insertion Chr2:16543207 - go to primer design
BLAST e Value 5e-27
Hit Clone Code (BAC ID) F17A14
Hit Gene Code At2g39690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37