DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_028169c
Line Availability available from NASC (N659768) and ABRC (SALK_028169c)
Confirmed for Hit At3g14020
Parent of DUPLO pair 411
Parent of pair(s) none

Gene hit At3g14020

 
Sequence (A. th genome BLAST matches underlined) 
GTTTCTTGTATCTTTATGAAAGGATTTGTTATGGAAATCTTTGCAGGTGCAGCATCCTCA
AATCAGAGGGTTGGTTCCGTCTAAAATGCCTTTGCCTCACAACATTCCAGAGAACGAACC
AATTTTCTTCCATGCAAAAAAATACCTAGCCATTCTCCGCCGCAGAGAGCCCCCTGCCAA
GCT
GenBank Accession BZ761621 [GenBank]
Graphic View Graphic view of gene At3g14020
Predicted Position of Insertion Chr3:4643654 - go to primer design
BLAST e Value 4e-68
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g14020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit A6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BZ761621 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37