DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_030147 |
| Line Availability | available from NASC (N530147) and ABRC (SALK_030147) |
| Confirmed for Hit | At5g18180 |
| Parent of DUPLO pair | 998 |
| Parent of pair(s) | none |
Gene hit At5g18180
| Sequence (A. th genome BLAST matches underlined) | GCGATAAGTTCTTCATTAGCCCTGAGAAGCT |
| GenBank Accession | BH749736 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:6008909 - go to primer design |
| BLAST e Value | 4e-10 |
| Hit Clone Code (BAC ID) | MRG7 |
| Hit Gene Code | At5g18180 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BH749736 [GenBank] |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 