DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_031878
Line Availability available from NASC (N531878) and ABRC (SALK_031878)
Confirmed for Hit At4g25070
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g25070

 
Sequence (A. th genome BLAST matches underlined) 
GAGGAATGAGGGAGCTAAGGAAGCTGATCNACTCCTCTTTTCTTCCTTCTTATTCCGTTT
CTGACTACTATGACGAGTGACCACCTCTACTCTCCTCTTTGCCTCCAATTTTCTTTATTC
ACGACACACGCTCACATAAACATACACGTACACACAC
GenBank Accession ED579275 [GenBank]
Graphic View Graphic view of gene At4g25070
Predicted Position of Insertion Chr4:12876415 - go to primer design
BLAST e Value 3e-62
Hit Clone Code (BAC ID) F13M23
Hit Gene Code At4g25070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation caldesmon-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37