DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_035775c
Line Availability available from NASC (N655433) and ABRC (SALK_035775c)
Confirmed for Hit At5g48950
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g48950

 
Sequence (A. th genome BLAST matches underlined) 
TTACTTATGTTGTTTGAACTAACTAGAGGGTTAGACAATATATGATATAGAGTATGATTT
TTTTTTTACAATCGGCCTTTTACATATTGTTGACACACCGGAAGCAAAAAAATAATCAAA
ATAAATTATTTATCTCCCATTTAATTGAAAAATCTTTTAAATTGTATTGGTATGGCAAAT
ATAAATAAATTTCTATGAGTATAGTTAACATAAATTTCAGCATTCGTATGCTTTATTAA
GenBank Accession BH906766 [GenBank]
Graphic View Graphic view of gene At5g48950
Predicted Position of Insertion Chr5:19845722 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) K19E20
Hit Gene Code At5g48950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Thioesterase superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit queueing for submission to ENA/GenBank


Last Updated on Thursday, 10 June 2021 13:37