DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_036447c |
Line Availability | available from NASC (N677687) and ABRC (SALK_036447c) |
Confirmed for Hit | At4g02650 |
Parent of DUPLO pair | none |
Parent of pair(s) | 2735 |
Gene hit At4g02650
Sequence (A. th genome BLAST matches underlined) | CTTGTCGTCCAACAGGTAATAATTA |
GenBank Accession | BH906900 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr4:1157209 - go to primer design |
BLAST e Value | 1e-06 |
Hit Clone Code (BAC ID) | T10P11 |
Hit Gene Code | At4g02650 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | ENTH/ANTH/VHS superfamily protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |