DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_037536
Line Availability available from NASC (N537536) and ABRC (SALK_037536)
Confirmed for Hit At5g35750
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g35750

 
Sequence (A. th genome BLAST matches underlined)
GTTATTTACGTAATAACAGATCACACATGAACGGGGACACATATTTATCTCAGAGCACCT
TGAAGATGATGCAAAGGAGCCTCTTACTATTGAAGAGGCTGTGCTAA
GenBank Accession BH754203 [GenBank]
Graphic View Graphic view of gene At5g35750
Predicted Position of Insertion Chr5:13913312 - go to primer design
BLAST e Value 8e-31
Hit Clone Code (BAC ID) MXH1
Hit Gene Code At5g35750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histidine kinase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37