DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_038310c
Line Availability available from NASC (N658194) and ABRC (SALK_038310c)
Confirmed for Hit At3g02800
Parent of DUPLO pair 2649
Parent of pair(s) 988

Gene hit At3g02800

 
Sequence (A. th genome BLAST matches underlined) 
GAACGAAGATTTAGGGTTTTAAGGAAACTGAAATTCTCAGGTCGAGGAAACCCAGATCGA
TAAATTCCATCTTCAACCATCGAGAAATTCGACGGCGGCGCTAAAACATCACCGTTGTGA
TCATCCGTTTCCATAATCAAACACATCGAATT
GenBank Accession ED583474 [GenBank]
Graphic View Graphic view of gene At3g02800
Predicted Position of Insertion Chr3:607559 - go to primer design
BLAST e Value 2e-81
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tyrosine phosphatase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37