DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_040299c
Line Availability available from NASC (N653157) and ABRC (SALK_040299c)
Confirmed for Hit At1g03470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g03470

 
Sequence (A. th genome BLAST matches underlined) 
CATTTGCTTTCACCGTTATCTATTTCAGACTCCGCATACTCCTCATGAGTCTCACAAGCC
TCAGACCAAGAAGACTCATCACAAGTTGATGATTTCTCATGACTCTCCGAGTCTGAGCCA
TGTTTATGCACAGAAGAGGGTCTCAACAAGTCGTACCTCTCGGCCAAGGAGCGATGTGAA
CGGTAGAATT
GenBank Accession ED585764 [GenBank]
Graphic View Graphic view of gene At1g03470
Predicted Position of Insertion Chr1:866635 - go to primer design
BLAST e Value 1e-104
Hit Clone Code (BAC ID) F21B7
Hit Gene Code At1g03470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Kinase interacting (KIP1-like) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED585764 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37