DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_047862c
Line Availability available from NASC (N653188) and ABRC (SALK_047862c)
Confirmed for Hit At5g38150
Parent of DUPLO pair 12268
Parent of pair(s) none

Gene hit At5g38150

 
Sequence (A. th genome BLAST matches underlined) 
GTTTCTTCCGCTTGTGAAGCATGTTTACTCAAATACTCGTACTCAAACCTCGAGATAGTG
ATTGTTGAACAATGCTCAGACTCCATTTCGCGACTCTCCATCATGTCTTCTACTAAAGAT
TCAAGCTTCTGAAGGACTAAAGCCATCACGTGGTTCAATTTTTCAGAGCTCATCCAACTT
TGAATT
GenBank Accession BH749437 [GenBank]
Graphic View Graphic view of gene At5g38150
Predicted Position of Insertion Chr5:15223483 - go to primer design
BLAST e Value 7e-76
Hit Clone Code (BAC ID) MXA21
Hit Gene Code At5g38150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PLASTID MOVEMENT IMPAIRED protein (DUF827)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37