DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_054181c
Line Availability available from NASC (N662501) and ABRC (SALK_054181c)
Confirmed for Hit At2g31450
Parent of DUPLO pair 2694
Parent of pair(s) none

Gene hit At2g31450

 
Sequence (A. th genome BLAST matches underlined) 
GCTCTTTGGACGACCTGGTGCCTCTTTCCCAGGGATAGGTCCCAAGATGGCCCATCTGGT
AAAATTCGACTATATTATTACTTATATCTTGTGAGTTTTAGATGAAATGTTTTCAAAAAG
CT
GenBank Accession BH756766 [GenBank]
Graphic View Graphic view of gene At2g31450
Predicted Position of Insertion Chr2:13402042 - go to primer design
BLAST e Value 7e-50
Hit Clone Code (BAC ID) T28P16
Hit Gene Code At2g31450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA glycosylase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37