DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_058951c |
Line Availability | available from NASC (N658715) and ABRC (SALK_058951c) |
Confirmed for Hit | At1g10700 |
Parent of DUPLO pair | 110 |
Parent of pair(s) | none |
Gene hit At1g10700
Sequence (A. th genome BLAST matches underlined) | ATGGTTATAGGAGACGATGAATT |
GenBank Accession | ED590875 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr1:3554413 - go to primer design |
BLAST e Value | 1e-05 |
Hit Clone Code (BAC ID) | F20B24 |
Hit Gene Code | At1g10700 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | phosphoribosyl pyrophosphate (PRPP) synthase 3 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | ED590875 [GenBank] |
Last Updated on Thursday, 10 June 2021 13:37 |