DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_058951c |
| Line Availability | available from NASC (N658715) and ABRC (SALK_058951c) |
| Confirmed for Hit | At1g10700 |
| Parent of DUPLO pair | 110 |
| Parent of pair(s) | none |
Gene hit At1g10700
| Sequence (A. th genome BLAST matches underlined) | ATGGTTATAGGAGACGATGAATT |
| GenBank Accession | ED590875 [GenBank] |
| Graphic View |
|
| Predicted Position of Insertion | Chr1:3554413 - go to primer design |
| BLAST e Value | 1e-05 |
| Hit Clone Code (BAC ID) | F20B24 |
| Hit Gene Code | At1g10700 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | phosphoribosyl pyrophosphate (PRPP) synthase 3 |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | ED590875 [GenBank] |
|
Last Updated on Thursday, 10 June 2021 13:37 |




gabi-kat.de 