DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_065596c |
Line Availability | available from NASC (N684877) and ABRC (SALK_065596c) |
Confirmed for Hit | At5g16790 |
Parent of DUPLO pair | 1900 |
Parent of pair(s) | none |
Gene hit At5g16790
Sequence (A. th genome BLAST matches underlined) | TTTGAATACTCATTCACGGGAATT |
GenBank Accession | ED595156 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:5523642 - go to primer design |
BLAST e Value | 4e-06 |
Hit Clone Code (BAC ID) | F5E19 |
Hit Gene Code | At5g16790 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Tho complex subunit 7/Mft1p |
Insertion Classification | TS2TE (5') |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |