DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_066841c |
Line Availability | available from NASC (N662797) and ABRC (SALK_066841c) |
Confirmed for Hit | At4g34950 |
Parent of DUPLO pair | 2532 |
Parent of pair(s) | none |
Gene hit At4g34950
Sequence (A. th genome BLAST matches underlined) | CGACACGAACAACACCCAAAAGTCAACGGTCAACATAG |
GenBank Accession | ED595923 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr4:16643610 - go to primer design |
BLAST e Value | 4e-14 |
Hit Clone Code (BAC ID) | F11I11 |
Hit Gene Code | At4g34950 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Major facilitator superfamily protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |