DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_087652c
Line Availability available from NASC (N657412) and ABRC (SALK_087652c)
Confirmed for Hit At1g55930
Parent of DUPLO pair 1104
Parent of pair(s) none

Gene hit At1g55930

 
Sequence (A. th genome BLAST matches underlined)
ATTGTGGCTGGTGGTCGAAACACCAATGGAACTGAGAGTTAAGATTTATCTGAGTTCGGA
GTCACTCGTGAAATGTTTGCAGAGAAG
GenBank Accession ED597668 [GenBank]
Graphic View Graphic view of gene At1g55930
Predicted Position of Insertion Chr1:20918790 - go to primer design
BLAST e Value 2e-40
Hit Clone Code (BAC ID) F14J16
Hit Gene Code At1g55930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CBS domain-containing protein / transporter associated domain-containing protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37