DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_091618c
Line Availability available from NASC (N654777) and ABRC (SALK_091618c)
Confirmed for Hit At1g04770
Parent of DUPLO pair 2089
Parent of pair(s) none

Gene hit At1g04770

 
Sequence (A. th genome BLAST matches underlined) 
GACGGTGACCTGAAACTTCTTGCCATGAGATCTCGCAGTCTTTGTTGGTTTGCCATTGAA
TGCTTCTCCTTGATATATCATCCAAAGCT
GenBank Accession BH902287 [GenBank]
Graphic View Graphic view of gene At1g04770
Predicted Position of Insertion Chr1:1337111 - go to primer design
BLAST e Value 5e-44
Hit Clone Code (BAC ID) F13M7
Hit Gene Code At1g04770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH902287 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37