DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_094943
Line Availability available from NASC (N594943) and ABRC (SALK_094943)
Confirmed for Hit At3g02990
Parent of DUPLO pair 2605
Parent of pair(s) none

Gene hit At3g02990

 
Sequence (A. th genome BLAST matches underlined) 
CAATTTTCTCAGCAGAGTAATGAAGCAAACCAACACATTTCTGAAAGCAACAAAAAGAGG
AGGCTACCTGTTGAGGACCAGATGAATT
GenBank Accession ED600171 [GenBank]
Graphic View Graphic view of gene At3g02990
Predicted Position of Insertion Chr3:675200 - go to primer design
BLAST e Value 2e-43
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat shock transcription factor A1E
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37