DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_096866
Line Availability available from NASC (N596866) and ABRC (SALK_096866)
Confirmed for Hit At1g35680
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g35680

 
Sequence (A. th genome BLAST matches underlined)
AGCTTGTTGAATCATACGAAACAACAAATTCTCAATTTCGGTGTTTAGCTTTTGGAATT
GenBank Accession ED601156 [GenBank]
Graphic View Graphic view of gene At1g35680
Predicted Position of Insertion Chr1:13209095 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) F15O4
Hit Gene Code At1g35680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L21
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED601156 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37