DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_105023c
Line Availability available from NASC (N663561) and ABRC (SALK_105023c)
Confirmed for Hit At5g04160
Parent of DUPLO pair none
Parent of pair(s) 2531, 97129, 97130, 97131

Gene hit At5g04160

 
Sequence (A. th genome BLAST matches underlined)
CAATAAGATCGTCTCTTCACAATGATACAAATTCAAAACACACAAAACAAGGATATGATA
TAACCACTTGACAAGCT
GenBank Accession BZ597459 [GenBank]
Graphic View Graphic view of gene At5g04160
Predicted Position of Insertion Chr5:1143909 - go to primer design
BLAST e Value 6e-37
Hit Clone Code (BAC ID) F21E1
Hit Gene Code At5g04160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-sugar transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37