DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_108151c |
Line Availability | available from NASC (N663618) and ABRC (SALK_108151c) |
Confirmed for Hit | At1g79400 |
Parent of DUPLO pair | 2621 |
Parent of pair(s) | none |
Gene hit At1g79400
Sequence (A. th genome BLAST matches underlined) | AAGGACTTTGCTTACGAAAAGACTTCGCTTGAATCTC |
GenBank Accession | BZ378465 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr1:29866562 - go to primer design |
BLAST e Value | 9e-09 |
Hit Clone Code (BAC ID) | T8K14 |
Hit Gene Code | At1g79400 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | cation/H exchanger 2 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |