DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_115539
Line Availability available from NASC (N615539) and ABRC (SALK_115539)
Confirmed for Hit At3g62590
Parent of DUPLO pair 17
Parent of pair(s) none

Gene hit At3g62590

 
Sequence (A. th genome BLAST matches underlined) 
ATTCTCNGTGATCGGCGTTCTTACGGATCGGAAAGAAAATTANAAGAAACTTTGACTGAG
CTCTTACCTGAAGGCCTTGAGGGATGTGATCCGGAAGGACCTTAAACATATGAAAGCTGA
GCGGGATCTATGGCTGGCCCAGTTCTTTTTTATAAACATTTTATTTGGGGGGAGAGATTC
TTTGAAACTTGTAACAAGAATCGTGGGGTCAAGGGATAGGTCCCCTAGTGATCATCTTCT
TTTCTCCCACTTAAATTGGTTATAATG
GenBank Accession BZ380701 [GenBank]
Graphic View Graphic view of gene At3g62590
Predicted Position of Insertion Chr3:23148296 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) T12C14
Hit Gene Code At3g62590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37