DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_124063c
Line Availability available from NASC (N684540) and ABRC (SALK_124063c)
Confirmed for Hit At4g14455
Parent of DUPLO pair 1406
Parent of pair(s) none

Gene hit At4g14455

 
Sequence (A. th genome BLAST matches underlined) 
ATTCTCCCTACCAAAGTCACGACCATTGGGTCTTAGTCATATCCGATTTTCTCCGATTCT
AGTTGGATACTCTACATTCCGGATCTGGAAAACTGGGATTAGAACTCCNAGAATTAGGTA
CAATGACTCAGAATCAGGAATT
GenBank Accession BZ764179 [GenBank]
Graphic View Graphic view of gene At4g14455
Predicted Position of Insertion Chr4:8310805 - go to primer design
BLAST e Value 4e-21
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14455 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Target SNARE coiled-coil domain protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37