DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_126353c
Line Availability available from NASC (N668997) and ABRC (SALK_126353c)
Confirmed for Hit At5g64400
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g64400

 
Sequence (A. th genome BLAST matches underlined)
TTATTCAATCCTTTCCGCTGGATTTAATTATTTTTAAATCATTCTTTCTGGG
GenBank Accession BZ355092 [GenBank]
Graphic View Graphic view of gene At5g64400
Predicted Position of Insertion Chr5:25749350 - go to primer design
BLAST e Value 4e-15
Hit Clone Code (BAC ID) MSJ1
Hit Gene Code At5g64400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CHCH domain protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37