DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_012298
Line Availability available from NASC (N512298) and ABRC (SALK_012298)
Confirmed for Hit At1g13800
Parent of DUPLO pair none
Parent of pair(s) 807

Gene hit At1g13800

 
Sequence (A. th genome BLAST matches underlined) 
ATCGGGGTGAAAAACCCACTTATGTTACACACAACATGGTCATTGAAGGCCTGATTGTTG
CAGGTGAACTAGACAAGGTTGAAGCT
GenBank Accession ED572867 [GenBank]
Graphic View Graphic view of gene At1g13800
Predicted Position of Insertion Chr1:4732227 - go to primer design
BLAST e Value 4e-35
Hit Clone Code (BAC ID) F16A14
Hit Gene Code At1g13800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED572867 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37