DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_015052
Line Availability available from NASC (N515052) and ABRC (SALK_015052)
Confirmed for Hit At5g52860
Parent of DUPLO pair none
Parent of pair(s) 2121, 88882, 88884

Gene hit At5g52860

 
Sequence (A. th genome BLAST matches underlined) 
AATCCAAAACCGGAAGCAGAGAGAGATCACAGTATTGCTCCATATAGAATATCCCGAATC
CTAGAGATAAGCCTTCTCGAGCCAAGATTCTGGAAGAT
GenBank Accession ED575144 [GenBank]
Graphic View Graphic view of gene At5g52860
Predicted Position of Insertion Chr5:21420676 - go to primer design
BLAST e Value 5e-07
Hit Clone Code (BAC ID) MXC20
Hit Gene Code At5g52860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC-2 type transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED575144 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37