DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_035827c
Line Availability available from NASC (N665767) and ABRC (SALK_035827c)
Confirmed for Hit At5g52240
Parent of DUPLO pair none
Parent of pair(s) 2115

Gene hit At5g52240

 
Sequence (A. th genome BLAST matches underlined) 
AACTAATCTTTATTTTTACCATACAATTTTTAAATAAAAAGTTATTTTCTTCTATAAGTA
AAATACAAATGATAATGTAGTACATGGGATTGTGTTAGTGTTTTTGATATGTCAAAATTC
GGGTTTCAAGTCTCTGCCGTAAAATAGATAGATTTTCGACGAAATAGAAAAGACATCAAG
CT
GenBank Accession ED583015 [GenBank]
Graphic View Graphic view of gene At5g52240
Predicted Position of Insertion Chr5:21212911 - go to primer design
BLAST e Value 3e-99
Hit Clone Code (BAC ID) F17P19
Hit Gene Code At5g52240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation membrane steroid binding protein 1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37