DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_076722
Line Availability available from NASC (N576722) and ABRC (SALK_076722)
Confirmed for Hit At5g40370
Parent of DUPLO pair none
Parent of pair(s) 2014

Gene hit At5g40370

 
Sequence (A. th genome BLAST matches underlined) 
CCAGAACAAAACACTATCCTTGGATCAAACAAAATCCTAAACTCGAATCACCGTAAACAA
GCAATAGAACAACAAGTATACCATTCCAAAAACGTTATCAACACAGCAAATGAAACGAAT
T
GenBank Accession BH853317 [GenBank]
Graphic View Graphic view of gene At5g40370
Predicted Position of Insertion Chr5:16148533 - go to primer design
BLAST e Value 5e-63
Hit Clone Code (BAC ID) MPO12
Hit Gene Code At5g40370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glutaredoxin family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH853317 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37