DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_078726c
Line Availability available from NASC (N656667) and ABRC (SALK_078726c)
Confirmed for Hit At4g25835
Parent of DUPLO pair none
Parent of pair(s) 2678, 97121

Gene hit At4g25835

 
Sequence (A. th genome BLAST matches underlined) 
GGGAGGACCACATAGCAAGTAGCCTCTTGTGCAAGTCCGAGCAGTTCTCTCGTAAAAAGA
TTGACGCTCAGCGAAATCTTTAACATCCTCCATGATCTGGTGCTTCTTAACCGGATCCAT
AGCGAGAGTATCGAAAGTACTCGGATGCTTAAAGGGAACAGATTCCCAAGGAAGACCTCT
AGAATCAAGAGACCCACCTCGTGAATT
GenBank Accession BH854091 [GenBank]
Graphic View Graphic view of gene At4g25835
Predicted Position of Insertion Chr4:13136854 - go to primer design
BLAST e Value 9e-88
Hit Clone Code (BAC ID) F14M19
Hit Gene Code At4g25835 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37